KOREAN

Current Issue

Korean Journal of Dental Materials - Vol. 49 , No. 4

[ Original Article ]
Korean Journal of Dental Materials - Vol. 49, No. 4, pp. 141-152
Abbreviation: Kor J Dent Mater
ISSN: 2384-4434 (Print) 2384-3268 (Online)
Print publication date 30 Dec 2022
Received 17 Oct 2022 Revised 24 Nov 2022 Accepted 02 Dec 2022
DOI: https://doi.org/10.14815/kjdm.2022.49.4.141

Inhibitory effects of surface-grafted polylactide-co-glycolide nanoparticles on the pro-inflammatory polarization of macrophages
Sang Hoon Choi ; Gyeung Mi Seon ; Quang Canh Vo ; Gitae Son ; Hyeong-Cheol Yang*
Department of Dental Biomaterials Science and Dental Research Institute, School of Dentistry, Seoul National University, Seoul, Republic of Korea

표면 개질된 PLGA 나노입자에 의한 대식세포의 염증유발 분극 억제효과
최상훈 ; 선경미 ; 보쾅칸 ; 손기태 ; 양형철*
서울대학교 치의학대학원 치과생체재료과학교실 및 치학연구소
Correspondence to : *Hyeong-Cheol Yang 101 Daehak-ro, Jongro-gu, Seoul 03080, Republic of Korea Affiliation: Department of Dental Biomaterials Science and Dental Research Institute, School of Dentistry, Seoul National University, Seoul, Republic of Korea Tel: +82-2-740-8695, Fax: +82-2-740-8694 E-mail: yanghc@snu.ac.kr

Funding Information ▼

Abstract

Phosphatidylserine (PS) mimics the anti-inflammatory effect of apoptotic cells by binding to the PS receptor of macrophages. In this study, the effect of PS-modified polylactide-co-glycolide (PLGA) nanoparticles on macrophage polarization was investigated. PLGA nanoparticles (PLGAnPs) containing phosphatidylcholine (PC) and PS were prepared using the emulsification-solvent-evaporation (ESE) technique and classified as follows: 1) PC 100% (PCnP); 2) PS:PC = 50:50 (PSPCnP); and 3) PS 100% (PSnP). PS-grafted PLGAnPs tended to inhibit LPS-induced morphological change into M1 macrophages and mRNA expression of the M1 markers (TNF-α, IL-1β, IL-6, IL-12p40, CD86, and iNOS). In particular, the expressions of TNF-α, IL-6, and IL-12p40 were significantly decreased in the PSPCnP group, as compared to those of the positive control and and PLGAnP groups (p<0.05). Therefore, the study results demonstrate the potential of PS-grafted PLGAnPs in attenuating inflammation and modulating the drug delivery system.

초록

기존 연구에서 포스파티딜세린(PS)은 대식세포의 PS 수용체와 결합하여 사멸세포의 항염증 작용을 모방하였다. 본 연구에서는 PS로 표면 개질된 PLGA (polylactide-co-glycolide) 나노입자가 마크로파지 분극에 미치는 영향을 알아보고자 하였다. Emulsification-solvent-evaporation (ESE) 기법을 활용하여 포스파티딜콜린(PC)과 PS를 함유한 PLGA 나노입자를 다음과 같이 제조하였다: 1) PC 100% (PCnP) 2) PS:PC=50:50 (PSPCnP) 3) PS 100% (PSnP). PS를 함유한 PLGA 나노입자는 LPS에 의한 M1 마크로파지로의 형태변화 및 M1 마커 (TNF-α, IL-1β, IL-6, IL-12p40, CD86, iNOS)의 mRNA 발현을 저해하는 경향을 보였다. 특히, 양성대조군 및 인지질이 부착되지 않은 PLGAnP군에 비해 PSPCnP군에서 TNF-α, IL-6, IL-12p40 발현이 유의미하게 감소하였다(p<0.05). 따라서, 이 연구의 결과는 염증을 약화시키고 약물 전달 시스템을 조절함에 있어 PS 이식 PLGA 나노입자의 잠재력을 보여준다.


Keywords: Macrophage, Phosphatidylserine, PLGA, Nanoparticles
키워드: 대식세포, 포스파티딜세린, 나노입자

Introduction

Macrophages are known to play a vital role in the inflammatory response and regeneration process. When inflammation occurs, neutrophils flow into the inflammation site. Then, monocytes arrive to differentiate into macrophages (1, 2). Macrophages can be classified into the following phenotypes: broadly M1 (classically activated) and M2 (alternatively activated) states (3). M1 macrophages are known to secrete a prominent level of pro-inflammatory cytokines [tumor necrosis factor-α (TNF-α), IL-1β, IL-6, and IL-12], and reactive oxygen and nitrogen species (4). Given that the M1 macrophages provoke an inflammatory environment, they can aggravate the inflammation impeding the wound healing procedure (5). The M2 macrophages, countering the M1 phenotype, are well known for their anti-inflammatory and tissue regeneration effects (6).

Phosphatidylserine (PS) is a type of phospholipid present inside of the healthy cell membrane bilayer. PS exposed outside of apoptotic cells acts as an “eat-me” signal, resulting in macrophage phagocytosis and anti-inflammatory activity. PS receptors on the macrophages bind with PS, and their interaction plays a key role in inflammatory modulation (7). The encounter between PS and PS receptors on macrophages provokes the inhibitory effect of inflammation (8). PS is frequently utilized in PS-contained liposomes (PSLs), which could mimic the anti-inflammatory apoptotic cells (9). PSLs inhibit an inflammation by deregulating the expression of M1 macrophages and inducing M2 polarization (10). The immunomodulatory effect of PSLs was determined to be reinforced with arginine-glycine-aspartate (RGD) peptides on surface and co-treatment with sodium butyrate (11, 12). These studies suggest that PS-contained nanosized particles have a potential for upregulating the immunomodulatory effect with other elements.

Polylactide-co-glycolide (PLGA) is a copolymer of lactic acid and glycolic acid. The ratio of two monomers affects their properties, including the biodegradation rate and hydrophilicity (13). PLGA has been used widely because of its biocompatibility, biodegradability, and mechanical strength. Due to these attributes, the PLGAnP is considered as one of the most suitable nanoparticles for drug delivery systems (14). The PLGAnP could be synthesized by numerous techniques, such as emulsification-evaporation [or emulsification-solvent-evaporation (ESE)], emulsification-diffusion, interfacial deposition, salting out, dialysis, and nanoprecipitation. The PLGAnP can be dissolved in highly hydrophobic and volatile solvents, such as dichloromethane, and chloroform using the ESE method (15).

Lipid surface-engineered PLGAnPs have been used in numerous studies owing to their biomimetic and biocompatible advantages (16). The synthesis methods can be categorized into the classical two-step and contemporary single-step processes (17). In the two-step method, the PLGAnPs are synthesized first and mixed with preformed liposomes later (18). In the single-step method, however, lipids are self-assembled around the PLGAnP core by hydrophobic interactions (19). The appropriate method for the experiment depends on numerous factors, including size, shape, and characteristics of the lipids (20).

In the present study, we hypothesized that PS on the surface of PLGAnPs would mimic the apoptotic cells to upregulate the immunomodulatory effects of macrophages. Furthermore, PS-PLGAnPs had been speculated to be able to improve the stability and stockage, as a carrier of PS.


Materials and Methods
1. Nanoparticle preparation

L-α-phosphatidylserine (PS, porcine brain) and L-α-phosphatidylcholine (PC, egg yolk) were purchased from Avanti Polar Lipids (Alabaster, AL, USA). Poly(D,L-lactide-co-glycolide) (PLGA, lactide:glycolide (50:50), MW: 30,000-60,000) and other reagents were purchased from Sigma-Aldrich Co. (Saint Louis, MO, USA), unless otherwise specified. The single ESE technique (w/o) was exploited to synthesize the nanoparticles (15). The composition of nanoparticles was shown in Table 1.

Table 1. 
Composition of nanoparticles
Nanoparticles PLGA PC PS
PLGAnP 40 mg 0 0
PCnP 40 mg 24 μmol 0
PSPCnP 40 mg 12 μmol 12 μmol
PSnP 40 mg 0 24 μmol

2. Characterization of nanoparticles

The size of the PLGAnP was measured by using a nanoparticle tracking analyzer (NanoSight, Malvern Panalytical, Malvern, UK). The surface charge of the nanoparticles was surveyed by using a zeta potential analyzer (ELSZ-1000, Otsuka Electronics Co., Ltd, Osaka, Japan). The zeta potential was gauged in distilled water using the following parameters: avg. electric field, -16.50 V/cm; avg. current, 0.00 mA; temperature, 25.0 ℃; refractive index, 1.3328; viscosity, 0.8878 cP; and dielectric constant, 78.3.

3. Cell culture of mouse bone marrow-derived macrophages

Mouse bone marrow-derived macrophages (BMDMs) were used to investigate the effects of nanoparticles on the polarization of macrophages. For this study, 5-week-old Institute of Cancer Research (ICR) male mice femur (OrientBio Inc. Seongnam, Korea) were used with humanely sacrifice.

4. Cell viability and cytotoxicity assay

Cell viability and cytotoxicity were measured using with water soluble tetrazolium salt (WST-8) assay kit (EZ-Cytox, Dogenbio, Seoul, Korea). After 12 h of treatment, washed out with DPBS twice and incubated on R10 media with 10% EZ-Cytox for 4 h. Absorbance was gauged using an enzyme-linked immunosorbent assay reader (Sunrise, TECAN, Salzburg, Austria) at 450 nm.

5. Morphological analysis

The mode of M1 macrophage polarization provides a useful system to study the macrophages in vitro. For the polarization of M1 phenotypes in this study, 50 ng/mL lipopolysaccharide (LPS) (Escherichia coli; serotype 0111: B4) was added to the culture medium for 12 h. To demonstrate the anti-inflammatory effect, 200 μg/mL of each nanoparticle was treated together with LPS.

6. Gene expression analysis by reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

To evaluate the anti-inflammatory effects of nanoparticles, macrophages were treated with nanoparticles in the presence of 50 ng/mL LPS for 6 h; then, the mRNA expression of pro-inflammatory genes (TNF-α, IL-1β, IL-6, IL-12p40, CD86, and iNOS) was assessed by RT-qPCR. The sequence of primers for RT-qPCR was shown in Table 2. The glyceraldehyde 3-phosphate dehydrogenase (GAPDH) gene was employed as a control housekeeper gene. The expression levels of all targeted cytokines were calculated based on their threshold cycle values and were noted as the relative mRNA expression ratios normalized to a reference gene (GAPDH).

Table 2. 
Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) primers
Genes Forward sequence Reverse sequence
GAPDH TGTGTCCGTCGTGGATCTGA CCTGCTTCACCACCTTCTTGAT
TNF-α GGCAGGTCTACTTTGGAGTCATTGC ACATTCGAGCCAGTGAATTCGG
IL-1β TGGAGAGTGTGGATCCCAAG GGTGCTGATGTACCA GTTGG
IL-6 ATAGTCCTTCCTACCCCAATTTCC GATGAATTGGATGGTCTTGGTCC
IL-12p40 AGCAGTAGCAGTTCCCCTGA AGTCCCTTTGGTCCAGTGTG
CD86 TCTCCACGGAAACAGCATCT CTTACGGAAGCACCCATGAT
iNOS ACCATGGAGCATCCCAAGTA CCATGTACCAACCATTGAAGG

7. Statistical analysis

All data obtained from three independent experiments were presented as the mean ± standard deviation (SD). Differences among the groups were assessed by one-way analysis of variance (one-way ANOVA) followed by Tukey’s test. Statistical analyses were performed using IBM SPSS 26 statistics software (IBM, Armonk, NY, USA). P values of <0.05 were considered statistically significant.


Results
1. Characteristics of nanoparticles

The effect of size of nanoparticle is substantial on their immunomodulatory function (21). The size differences of nanoparticles caused by phospholipids were measured and evaluated. As shown in Fig. 1, the mean diameters of PLGAnP, PCnP, PSPCnP, and PSnP were 212.6±60.4, 215.9±55.4, 209.1±58.1, and 207.0±53.3 nm, respectively. The average size among all the groups was not statistically significantly different. The zeta potential is a significant parameter used to assess the phospholipids attached to the surface of nanoparticles. PS is known as the most negatively charged glycerophospholipid in eukaryotic membranes (22). The zeta potential of PLGAnP, PCnP, PSPCnP, and PSnP was -2.38, -12.01, -15.47, and -16.28, respectively (Figure 1).


Figure 1. 
Nanoparticle size and zeta potential analyses. The size and particle distribution were no significant different between the PLGAnP, PCnP, PSPCnP, and PSnP groups. The zeta potentials were -2.38, -12.01, -15.47, and -16.28 for the PLGAnP, PCnP, PSPCnP, and PSnP groups, respectively. PLGAnPs, polylactide-co-glycolide nanoparticles; PCnP, phosphatidylcholine 100%; PSPCnP, phosphatidylserine:phosphatidylcholine = 50:50; PSnP, phosphatidylserine 100%

2. Effect of nanoparticles on cell viability and cytotoxicity assay

The effects of nanoparticles on the viability of BMDM were evaluated depending on concentration and type of nanoparticles. The cell viability of BMDM showed no difference on the respective concentration of PLGAnP) The cell viability of BMDM was not different with concentration dependency for PLGAnP (Figure 2A.). In Figure 2B, the treatment with different types of nanoparticles showed no significant difference in cytotoxicity. Therefore, none of the nanoparticles used in this study showed cytotoxicity.


Figure 2. 
Cell viability assay for nanoparticles. The WST-8 assay was performed with different concentrations of PLGAnP (A), and with various kinds of nanoparticles at 200 μg/mL (B). Relative cell viability indicates the ratio between test group and control group.

3. Effect of nanoparticles on cell morphology

The polarization of macrophages accompanies remarkable changes in cell shape. M1 macrophage exhibit a flat and spread like pancake shape, meanwhile M2 exhibit a spindle and elongated shape (23). Therefore, cell morphological changes could be observed under the optical microscope after 12 h treatment. Figure 3 shows that bone-marrow-derived macrophages are slightly spindle or round in untreated group. LPS stimulation induces the cells to become large, flat, and pancake-like, and co-treatment with PLGAnP and PCnP showed no significant difference. However, PSPCnP and PSnP prevent cell morphological change to the typical LPS-induced M1 shape. These figures suggest that cell shape is important cue for anti-inflammation effect.


Figure 3. 
Cellular morphological analysis. Cell shape changes are observed under an optical microscope. LPS stimulation induced the M1 polarization, while co-treatment with PSPCnP and PSP could prevent the cell morphological changes. Scale bar is 100 μm.

4. Effects of nanoparticles on macrophage mRNA expression of inflammation and polarization genes

To evaluate the anti-inflammatory effect of nanoparticles, mouse bone-marrow-derived macrophages were treated with nanoparticles in the presence of LPS. Then, the mRNA expression of inflammatory cytokines (TNF-a, IL-1β, IL-6, and IL-12p40), immunoglobulins (CD86), and enzyme release (iNOS) was assessed after 6 h of treatment by RT-qPCR. Figure 4AF shows that LPS (50 ng/mL) induced higher levels of these mRNAs, as compared to expression in the untreated cells. The mRNA expression of TNF-α and IL-6 was downregulated by nanoparticles, especially in the PSPCnP group (Figure 4A, C). Approximately 50% of IL-1β mRNA expression was declined by nanoparticles. However, there was no statistically significant difference among the experiment groups (Figure 4B). PLGAnP and PCnP did not affect the LPS-stimulated mRNA expression on the IL-12p40 marker, while PSPCnP and PSnP remarkably suppressed the expression (Figure 4D). Although there was no statistically significant difference in mRNA expression of CD86 and iNOS, PSPCnP showed a tendency to inhibit the expression (Figure 4E, F).


Figure 4. 
Effects of nanoparticle on mRNA expression of inflammation and polarization genes. (A–F) To assess the anti-inflammatory effect of nanoparticles, macrophages were cotreated with nanoparticles and LPS for 6 h. The mRNA expression of TNF-α, IL-1β, IL-6, IL-12p40, CD86, and iNOS genes were analyzed by reverse transcription-quantitative polymerase chain reaction (RT-qPCR). The data from four independent experiments are presented as means ± standard deviation (SD). Data bars with distinct letters represent statistically significant differences among the groups (p<0.05), and data bars with the same letters represent no significant differences (p>0.05).


Discussion

Due to its biodegradability and biocompatibility, PLGA has widely attracted attention as a biomaterial. PLGAnP has been used as a drug delivery system for inflammation, vaccination, cancer, and other diseases (24). The mean size of nanoparticles is a substantial factor in biomaterials, which affects various biosystems, such as cytotoxicity, macrophage polarization, and mesenchymal stem cell osteogenesis (21, 25). The mean size of nanoparticles is controlled by 1) PVA concentration in the aqueous phase, 2) surface lipid concentration in the aqueous phase, 3) PLGA concentration in the organic phase, 4) volume ratio of the aqueous solution, and 5) duration of ultrasonic dispersing treatment (sonication) (26). The proper size of PLGAnP ranged from 100 to 300 nm (27). The average size of nanoparticles was approximately 210 nm, which was not significantly different among the groups (Figure 1). The zeta potential also plays a crucial role in cytotoxicity and cellular interactions (22). Cytotoxicity derived from the PLGAnP was present when the zeta potential ranged from -13.2 to -19.3 mV (27). In Figure 1, phospholipid grafting has induced a surface charge difference, and the zeta potential of PSPCnP and PSnP was in the proper range. Thus, we could estimate that phospholipids had been attached to PLGAnP, and they had no effect on the size of the particles. The fact that PLGAnP had no cytotoxicity up to 1.5 mg/ml was confirmed in Figure 2A, which support the findings of a previous study (28). PLGAnP grafted on the surface could stunt the cell viability (29). We demonstrated that 200 μg/ml of nanoparticles had no cytotoxicity to BMDM (Figure 2B).

In the past, lipid-based surface-engineered PLGAnPs were focused on development of drug and gene delivery platforms. Thus, lipids were mainly used for characterizing nanocarriers (14). In other previous studies, macrophage polarization was regulated by mimicking the interaction between apoptotic cells and macrophages, induced with PS on the surface of liposomes or titanium (10-12, 30). Meanwhile, the present study focused on PS as the lipid on the surface of lipid-PLGAnPs and expected that PS-PLGAnPs had some similar effects to PS-liposomes in terms of immunomodulatory effects and macrophage polarization.

As shown in Figure 4AF, we observed anti-inflammatory effects of the nanoparticles, which was compared with those of IL-4. The LPS-induced gene expressions of IL-1β, IL-6, IL-12p40, and iNOS were repressed by IL-4. However, the mRNA levels of TNF-α and CD86 were not affected by IL-4. These incoherent effects of IL-4 can be described as its pleiotropic properties. The pleiotropic properties wrought the distinctive responsiveness of macrophages to IL-4, which was detected by the characteristic morphological change (Figure 3). Indeed, the co-treatment with LPS and IL-4 showed contrary results on TNF-α for 6 h in the present study and for 12 h in a previous study (11). It has been reported that pure PLGAnPs showed a tendency to downregulate the pro-inflammatory cytokines on murine bone-marrowderived macrophages, and a similar inclination was observed in this study (31). Among the phospholipid-engineered PLGAnPs, PSPCnP showed the strongest anti-inflammatory effect, which could be assessed by morphological changes and RT-qPCR results (Figures 3 and 4AF).

In this study, the lipid-grafted nanoparticles, especially PSPCnP, inhibited the polarization of M1 phenotype in inflammatory environment. In the pharmaceutical field, the research on inhibition of macrophage activation has been conducted mainly in the treatment of inflammatory diseases (32). Furthermore, numerous studies have generally used the single type of phospholipid for lipid surface-engineered PLGAnPs, synthesized using the single-step method (15, 33, 34). Meanwhile, the anti-inflammatory effect of nanoparticles was optimized at 50% mol of PS in phospholipids. These results correspond to those of the liposome experiments, reporting that the suggested mol% of PS was 30~50% (11, 35). Based on these results, we anticipate that the PS/PC-grafted PLGAnPs are a promising nanocarrier for inflammation. For clinical applications, the injections of nanoparticles directly to the inflammatory site is thought to be appropriate.


Conclusions

In this study, the therapeutic potential of phospholipid PS-engineered PLGAnPs was evaluated. The surface grafting of PLGAnPs with PS upregulated the anti-inflammatory activity of PLGAnP. The morphological change and gene expression of TNF-α, IL-6, IL-12p40, CD86, and iNOS in LPS-treated macrophages were more substantially suppressed by PSPCnP than by PLGAnP. Overall, the results of this study reveal that PS grafting, particularly PS:PC = 50:50 mol%, indicates the therapeutic potential of PLGAnPs, attenuating inflammation and modulating the drug delivery system.


Acknowledgments

This research was supported by National Research Foundation (2021R1A6A1A03039462 and 2022R1A2C1091981).


References
1. Shi C, Pamer EG. Monocyte recruitment during infection and inflammation. Nat Rev Immunol. 2011;11(11):762-74.
2. Orekhov AN, Orekhova VA, Nikiforov NG, Myasoedova VA, Grechko AV, Romanenko EB, et al. Monocyte differentiation and macrophage polarization. Vessel Plus. 2019;3:10.
3. Orecchioni M, Ghosheh Y, Pramod AB, Ley K. Macrophage polarization: different gene signatures in M1(LPS+) vs. classically and M2(LPS–) vs. alternatively activated macrophages. Front. Immunol. 2019;10.
4. Müller J, von Bernstorff W, Heidecke CD, Schulze T. Differential S1P receptor profiles on M1- and M2-polarized macrophages affect macrophage cytokine production and migration. BioMed Res. Int. 2017;2017:7584621.
5. Kotwal GJ, Chien S. Macrophage Differentiation in normal and accelerated wound healing. Results Probl. Cell Differ. 2017;62:353-64.
6. Raimondo TM, Mooney DJ. Functional muscle recovery with nanoparticle-directed M2 macrophage polarization in mice. Proc. Natl. Acad. Sci. U. S. A. 2018;115(42):10648-53.
7. Zhang G, Xue H, Sun D, Yang S, Tu M, Zeng R. Soft apoptotic cell-inspired nanoparticles persistently bind to macrophage membranes and promote anti-inflammatory and pro-healing effects. Acta Biomater. 2021;131:452–63.
8. Gordon S, Martinez FO. Alternative activation of macrophages: mechanism and functions. Immunity. 2010;32(5):593-604.
9. Rodriguez-Fernandez S, Pujol-Autonell I, Brianso F, Perna-Barrull D, Cano-Sarabia M, Garcia-Jimeno S, et al. Phosphatidylserine-Liposomes Promote Tolerogenic Features on Dendritic Cells in Human Type 1 Diabetes by Apoptotic Mimicry. Front. Immunol. 2018;9.
10. Quan H, Park HC, Kim Y, Yang HC. Modulation of the anti-inflammatory effects of phosphatidylserine-containing liposomes by PEGylation. J Biomed Mater Res A. 2017;105:1479–86.
11. Wu L, Kim Y, Seon GM, Choi SH, Park HC, Son G, Kim SM, Lim BS, Yang HC. Effects of RGD-grafted phosphatidylserine containing liposomes on the polarization of macrophages and bone tissue regeneration. Biomaterials. 2021;279:121239.
12. Wu L, Seon GM, Kim Y, Choi SH, Vo QC, Yang HC. Enhancing effect of sodium butyrate on phosphatidylserine-liposome-induced macrophage polarization. Inflamm Res. 2022;71(5-6):641-52.
13. Mensah RA, Kirton SB, Cook MT, Styliari ID, Hutter V, Chau DYS. Optimising poly(lactic-co-glycolic acid) microparticle fabrication using a Taguchi orthogonal array design-of-experiment approach. PLOS ONE. 2019;14(9):e0222858.
14. Sadat TMF, Nejati-Koshki K, Akbarzadeh A, Yamchi MR, Milani M, Zarghami N, et al. PLGA-based nanoparticles as cancer drug delivery systems. Asian Pac. J. Cancer Prev. 2014;15(2):517-35.
15. Moghaddam FA, Ebrahimian M, Oroojalian F, Yazdian-Robati R, Kalalinia F, Tayebi L, Hashemi M. Effect of thymoquinone-loaded lipid–polymer nanoparticles as an oral delivery system on anticancer efficiency of doxorubicin. J. Nanostruct. Chem. 2022;12(1):33-44.
16. Hu Y, Ehrich M, Fuhrman K, Zhang C. In vitro performance of lipid-PLGA hybrid nanoparticles as an antigen delivery system: lipid composition matters. Nanoscale Res. Lett. 2014;9(1):434.
17. Bose RJ, Lee SH, Park H. Biofunctionalized nanoparticles: an emerging drug delivery platform for various disease treatments. Drug Discov Today. 2016;21(8):1303-12.
18. Sengupta S, Eavarone D, Capila I, Zhao G, Watson N, Kiziltepe T, Sasisekharan R. Temporal targeting of tumour cells and neovasculature with a nanoscale delivery system. Nature. 2005;436(7050):568-72.
19. Yang XZ, Dou S, Wang YC, Long HY, Xiong MH, Mao CQ, et al. Single-step assembly of cationic lipid–polymer hybrid nanoparticles for systemic delivery of siRNA. ACS Nano. 2012;6(6):4955-65.
20. Hasan W, Chu K, Gullapalli A, Dunn SS, Enlow EM, Luft JC, et al. Delivery of multiple siRNAs using lipid-coated PLGA nanoparticles for treatment of prostate cancer. Nano Lett. 2012;12(1):287-92.
21. Mahon OR, Browe DC, Gonzalez-Fernandez T, Pitacco P, Whelan IT, Von Euw S, et al. Nano-particle mediated M2 macrophage polarization enhances bone formation and MSC osteogenesis in an IL-10 dependent manner. Biomaterials. 2020;239:119833.
22. Birge RB, Boeltz S, Kumar S, Carlson J, Wanderley J, Calianese D, et al. Phosphatidylserine is a global immunosuppressive signal in efferocytosis, infectious disease, and cancer. Cell Death Differ. 2016;23(6):962-78.
23. cWhorter FY, Wang T, Nguyen P, Chung T, Liu WF. Modulation of macrophage phenotype by cell shape. Proc Natl Acad. Sci. 2013;110:17253–8.
24. Danhier F, Ansorena E, Silva JM, Coco R, Le Breton A, Préat V. PLGA-based nanoparticles: an overview of biomedical applications. J. Control Release. 2012;161(2):505-22.
25. Ibrahim WN, Muizzuddin Bin Mohd Rosli L, Doolaanea AA. Formulation, cellular uptake and cytotoxicity of thymoquinone-loaded PLGA nanoparticles in malignant melanoma cancer cells. Int J Nanomed. 2020;15:8059-74.
26. Feczkó T, Tóth J, Dósa G, Gyenis J. Influence of process conditions on the mean size of PLGA nanoparticles. Chem Eng Process Process Intensif. 2011;50(8):846-53.
27. Chiu HI, Samad NA, Fang L, Lim V. Cytotoxicity of targeted PLGA nanoparticles: a systematic review. RSC Adv. 2021;11(16):9433-49.
28. Mihalik NE, Wen S, Driesschaert B, Eubank TD. Formulation and in vitro characterization of PLGA/PLGA-PEG nanoparticles loaded with murine granulocyte-macrophage colony-stimulating factor. AAPS PharmSciTech. 2021;22(5):191.
29. Yasar H, Biehl A, De Rossi C, Koch M, Murgia X, Loretz B, Lehr CM. Kinetics of mRNA delivery and protein translation in dendritic cells using lipid-coated PLGA nanoparticles. J Nanobiotechnol. 2018;16(1):72.
30. Quan H, Kim Y, Wu L, Park HC, Yang HC. Modulation of macrophage polarization by phospholipids on the surface of titanium. Molecules. 2020;25(11)2700.
31. Azadpour M, Farajollahi MM, Dariushnejad H, Varzi AM, Varezardi A, Barati M. Effects of synthetic silymarin-PLGA nanoparticles on M2 polarization and inflammatory cytokines in LPS-treated murine peritoneal macrophages. Iran. J Basic Med Sci. 2021;24(10):1446-54.
32. Suzuki E, Umezawa K. Inhibition of macrophage activation and phagocytosis by a novel NF-κB inhibitor, dehydroxymethylepoxyquinomicin. Biomed Pharmacother. 2006;60(9):578-86.
33. Ebrahimian M, Mahvelati F, Malaekeh-Nikouei B, Hashemi E, Oroojalian F, Hashemi M. Bromelain loaded lipid-polymer hybrid nanoparticles for oral delivery: formulation and characterization. Appl Biochem Biotechnol. 2022;194:3733–3748.
34. Cheow WS, Hadinoto K. Factors affecting drug encapsulation and stability of lipid–polymer hybrid nanoparticles. Colloids Surf., B 2011;85(2):214-20.
35. Fadok VA, Bratton DL, Rose DM, Pearson A, Ezekewitz RA, Henson PM. A receptor for phosphatidylserine-specific clearance of apoptotic cells. Nature. 2000;405 (6782):85-90.